morphometric and molecular analysis of gyrodactlus kobayashi in carassius auratus (linnaeus, 1758)

background: fish are constantly exposed to various pathogens and parasites in particular. gyrodactylus from platyhelminthes is an important monogenean ectoparasite that can cause disease and economical losses to cultured, wild, salt and fresh water and ornamental fish. gyrodactylus appears to be one of the most prevalent parasites of ornamental fish especially in cyprinids. objectives: the present study aimed to identify morphometric and molecular characteristics of gyrodactylus parasite on carassius auratus (linnaeus, 1758). methods: gyrocactylus parasites were isolated from skin, fins and gills of the fish with wet mount slide and were examined under light microscopy. the morphometrical characterization of gyrodactylus specimens was performed using the measurements and drawings of opisthaptoral hard parts of the parasites. the molecular species description was based on polymerase chain reaction (pcr) of partial sequence of 5.8s region of ribosomal rna (5´cgatcatcggtctctcgaac3´) and partial sequence of internal transcribed spacer2 (its2) of ribosomal rna (5´ttaaggaagaaccactagag3´). results: gyrodactylus species morphology identification was performed using yamaguti (1961) identification key. the nucleotide sequences of the pcr products were compared with genbank sequences. conclusions: based on morphometric analysis and sequencing, the gyrodactylus specimens were described as gyrodactylus kobayashi. combination of molecular techniques with morphological analysis seems to be the best approach to identification of gyrodactylus spices.